URLhttps://www.bco-dmo.org/dataset/641358
Download URLhttps://www.bco-dmo.org/dataset/641358/data/download
Media Typetext/tab-separated-values
CreatedMarch 25, 2016
ModifiedNovember 15, 2016
StateFinal no updates expected
Brief DescriptionQuantitative PCR data from sediment samples

Acquisition Description

Sampling and Analytical Methodology:
Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil
(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the
primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was
below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used
for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a
BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA
gene PCR products from plasmids containing amplified partial 16S genes were used as standards.

 

Primers Used:

Primer name     Sequence (5' - 3')           Target          Reference
Bac340f         TCCTACGGGAGGCAGCAGT          Bacteria        Nadkarni et al., 2002
Bac 515r        CGTATTACCGCGGCTGCTGGCAC      Bacteria        Nadkarni et al., 2002
Arch915f        GTGCTCCCCCGCCAATTCCT         Archaea         Kubo et al., 2012
Arch1059r       GCCATGCACCWCCTCT             Archaea         Kubo et al., 2012
ANME1-628f      GCT TTC AGG GAA TAC TGC      ANME-1          Lloyd et al., 2011
ANME1-830r      TCG CAG TAA TGC CAA CAC      ANME-1          Lloyd et al., 2011
MCG528f         CGGTAATACCAGCTCTCCGAG                        Kubo et al., 2012
MCG732r         CGCGTTCTAGCCGACAGC                           Kubo et al., 2012

 

Primers used from the following publications:
Archaea of the Miscellaneous Crenarchaeotal Group are abundant, diverse and widespread in marine sediments

Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set

Environmental evidence for net methane production and oxidation in putative ANaerobic MEthanotrophic (ANME) archaea

Processing Description

Data Processing:
Absolute quantification was calculated by converting Ct values of samples into copy numbers per
microliter of DNA with the linear equation produced by the standard curve with R2 greater than 0.95.
The quantification limit was defined as having fluorescence threshold cycle numbers (Ct) well within
those of the simultaneously-run standard curve and being at least 3 Ct below the non-template control
Ct.

BCO-DMO Processing Notes
- Generated from original file "qPCR Exp IODP 347.xlsx, sheet: qPCR" contributed by Joy Buongiorno
- Parameter names edited to conform to BCO-DMO naming convention found at Choosing Parameter Name
- Latitude and Longitude for sample inserted from Sites data
- "nd" (no data) inserted into blank cells

Instruments

BioRad iQ5 [PCR Thermal Cycler]
Details
Instance Description (BioRad iQ5)

Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil
(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the
primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was
below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used
for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a
BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA
gene PCR products from plasmids containing amplified partial 16S genes were used as standards.

BioRad iQ5

General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps.

(adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)

FastDNA® Spin Kit for Soil [PCR Thermal Cycler]
Details
Instance Description (FastDNA® Spin Kit for Soil)

Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil
(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the
primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was
below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used
for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a
BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA
gene PCR products from plasmids containing amplified partial 16S genes were used as standards.

FastDNA® Spin Kit for Soil

General term for a laboratory apparatus commonly used for performing polymerase chain reaction (PCR). The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps.

(adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)

Parameters

Identifier [sample]
Details
Identifier
Sample Identifier

unique sample identification or number; any combination of alpha numeric characters; precise definition is file dependent

Depth [depth_core]
Details
Depth
Depth of sample in core
depth in core; mid-point of interval sampled
Archaea_replicate_1 [unknown]
Details
Archaea_replicate_1
Archaea replicate 1 (Units are copies of target DNA per microliter of DNA)
association with a community-wide standard parameter is not yet defined
Archaea_replicate_2 [unknown]
Details
Archaea_replicate_2
Archaea replicate 2 (Units are copies of target DNA per microliter of DNA)
association with a community-wide standard parameter is not yet defined
Bacteria_replicate_1 [unknown]
Details
Bacteria_replicate_1
Bacteria replicate 1 (Units are copies of target DNA per microliter of DNA)
association with a community-wide standard parameter is not yet defined
Bacteria_replicate_2 [unknown]
Details
Bacteria_replicate_2
Bacteria replicate 2 (Units are copies of target DNA per microliter of DNA)
association with a community-wide standard parameter is not yet defined
ANME1_replicate_1 [unknown]
Details
ANME1_replicate_1
ANME1 replicate 1 (Units are copies of target DNA per microliter of DNA)
association with a community-wide standard parameter is not yet defined
ANME1_replicate_2 [unknown]
Details
ANME1_replicate_2
ANME1 replicate 2 (Units are copies of target DNA per microliter of DNA)
association with a community-wide standard parameter is not yet defined
MCG_replicate_1 [unknown]
Details
MCG_replicate_1
MCG replicate 1 (Units are copies of target DNA per microliter of DNA)
association with a community-wide standard parameter is not yet defined
MCG_replicate_2 [unknown]
Details
MCG_replicate_2
MCG replicate 2 (Units are copies of target DNA per microliter of DNA)
association with a community-wide standard parameter is not yet defined

Dataset Maintainers

NameAffiliationContact
Karen G. LloydUniversity of Tennessee Knoxville (UTK)
Andrew D. SteenUniversity of Tennessee Knoxville (UTK)
Karen G. LloydUniversity of Tennessee Knoxville (UTK)
Stephen R. GeggWoods Hole Oceanographic Institution (WHOI BCO-DMO)

BCO-DMO Project Info

Project TitleQuantifying the contribution of the deep biosphere in the marine sediment carbon cycle using deep-sea sediment cores from the Baltic Sea
AcronymIODP-347 Microbial Quantification
URLhttps://www.bco-dmo.org/project/639417
CreatedFebruary 29, 2016
ModifiedDecember 6, 2017
Project Description

Marine sediments contain a microbial population large enough to rival that of Earth's oceans, but much about this vast community is unknown. Innovations in total cell counting methods have refined estimates of cell concentrations, but tell us nothing about specific taxa. Isotopic data provides evidence that a majority of subsurface microorganisms survive by breaking down organic matter, yet measurable links between specific microbial taxa and their organic matter substrates are untested. The proposed work overcomes these limitations, with a particular focus on the degradation of proteins and carbohydrates, which comprise the bulk of classifiable sedimentary organic matter. The project will link specific taxa to potential extracellular enzyme activity in the genomes of single microbial cells, apply newly-identified, optimal methods for counting viable cells belonging to specific taxa using catalyzed reporter deposition fluorescent in situ hybridization (CARD-FISH), and measure the potential activity of their enzymes in situ. The resulting data will provide key evidence about the strategies subsurface life uses to overcome extreme energy limitation and contribute to the long-term carbon cycle.

The Principal Investigators are employing novel,improved methods to quantify cells of specific taxa in the marine subsurface and to determine the biogeochemical functions of those uncultured taxa, including:
1) Determine the pathway of organic carbon degradation in single cell genomes of uncultured, numerically dominant subsurface microorganisms.
2) Quantify viable bacteria and archaea in the deep subsurface using an improvement on the existing technology of CARD-FISH.
3 )Measure the potential activities (Vmax values) of enzymes in deep Baltic Sea sediments, and use the abundances of enzyme-producing microorganisms to calculate depth profiles of cell-specific Vmax values.

The project combines these methods in order to identify and quantify the cells capable of degrading organic matter in deep sediments of the Baltic Sea, obtained from Integrated Ocean Drilling Program (IODP) expedition 347. These results will greatly expand our knowledge of the function and activity of uncultured microorganisms in the deep subsurface.

This project is associated with C-DEBI account number 157595.

Project Maintainers
NameAffiliationRoleContact
Karen G. LloydUniversity of Tennessee Knoxville (UTK)Principal Investigator
Andrew D. SteenUniversity of Tennessee Knoxville (UTK)Co-Principal Investigator
Menu