Instrument Type: PCR Thermal Cycler

This study included cold seep and hydrothermal vent sediments from along the Pacific coast of North America. Sediments were collected via 30 cm long polycarbonate pushcores from a cold methane seep at Hydrate Ridge (44°34'10. 20"N, 125° 8'48. 48"W) at 777 m water depth with the ROV Ropos (Dive 1458); hydrothermal vents at Guaymas Basin, Gulf of California (27°0'27.84"N, 111°24'27.84"W) at 2000 m with the DSV Alvin (Dive 4486); and hydrothermal vents at Middle Valley, Juna de Fuca Ridge (48°27'26.40"N, 128°42'30.60"W) at 2413 m with the DSV Alvin (Dive 4625). For this study, a total of three pushcores were collected from Hydrate Ridge at 4°C, one from Guaymas Basin at 30-35°C, and one from Middle Valley at 5–57°C (Table 4.1). Total genomic DNA was extracted using a phenol-chloroform protocol modified to prevent nucleic acid loss and eliminate potential inhibitors of downstream PCR, and which has been very successful in studies of low biomass sediments (Adams et al. 2013). PCR amplification was performed with primers designed to be universal to both archaea and bacteria (515F/806R) (Caporaso et al., 2012), containing attached Illumina adaptors and barcodes (Kozich et al., 2013). All DNA extracts were amplified in duplicate with OmniTaq (Taq mutant) polymerase according to the manufacturer’s instructions (DNA Polymerase Technologies, St. Louis, MO, USA), with a final concentration of 0.2 μM for each primer. For each PCR, 1 μL template DNA was added to the final reaction mixture for a final volume of 50 μl. Amplification conditions were as follows: 94°C for 3 min to denature DNA; 30 cycles at 94°C for 45 s, 50°C for 60 s, and 72°C for 60 s; and a final extension of 10 min at 72 °C.

Methodology from Fullerton and Moyer (2016). See paper for references cited below.

Sample collection. Subsurface sediments were collected on IODP expedition 331 (Deep Hot Biosphere) from 1 September through 4 October 2010 (Fig. 1). Onboard contamination testing of sites C0015 (126°53=E, 27°47=N; hole B; section 1H-5; 5.6mbsf) and C0017 (126°55=E, 27°47=N; hole C; section 1H-7; 26.6 m bsf) found no indication of interior-core contamination using fluorescent microspheres (both holes C0015B and C0017C) and perfluorocarbon tracer (hole C0017C only). The sample from hole C0017C was also verified by PCR-generated phylotype comparisons based on 97% similarity to phylotypes obtained from drilling mud at a contamination level of 1% or less (26). Subsamples were aseptically collected from the interiors of whole-round cores and stored in cryovials with 27% (vol/vol) glycerol at -80°C.

Single-cell source. Core depths were chosen from sites C0015 and C0017, which were characterized as weakly oxidized pumiceous gravels with no detected sulfide mineralization and less than 0.1 wt% total organic carbon, total nitrogen, and total sulfur (25). The selected samples for single-cell genomes were from subsurface depths of 5.6 m bsf from hole C0015B and from 26.6 m bsf from hole C0017C. Temperatures were estimated at ~10.5°C for C0015B and ~8.1°C for C0017C at these depths. Details of geochemistry and lithography have been previously described (12, 24, 25).

Single-cell sorting, amplification, sequencing, and annotation. Samples from sites C0015 and C0017 (Fig. 1) were diluted with 1 ml of filter-sterilized artificial seawater (27), making a slurry, and then passed through a 90-um nylon mesh filter twice and centrifuged at ~500 ug for 2 min to produce a particle-free cell suspension. The suspension was then processed using fluorescence-activated single-cell sorting at the Single Cell Genome Center (SCGC) at Bigelow Laboratory for Ocean Sciences. Single-cell sorting and multiple displacement amplification (MDA) have been previously described (28). The amplified SSU rRNA gene sequences (27F/907R) were classified using the Ribosomal Database Project (RDP) online classifier (28, 29). Based on their SSU rRNA gene identities, nine Chloroflexi SAGs (of the total 29 unique MDA reactions identified after cell sorting) were chosen for whole-genome sequencing. These SAGs were sequenced and assembled, and contamination was checked by the SCGC, using previously well-described parameters (28, 29). Assembly was done using SPAdes v.3.0.0 (30). All contigs were compared to ensure no cross contamination among SAGs and the NCBI nt database, which was followed by tetramer principal-component analysis as previously described (31-33). These analyses revealed no contamination. The full name for each of the SAGs was shortened, e.g., Anaerolineales bacterium SCGC AC-711-B22 was shortened to An-B22. Phylogeny was abbreviated as follows: Anaerolineales to An, Dehalococcoidales to De, and Thermoflexales to Th. The assembled genomes were annotated using RAST (34). Gene annotations were compared to NCBI GenBank via BLASTn, and the results can be found in Tables S2 to S4 in the supplemental material.

The Anaerolineales SAGs were compared to the genome of Anaerolinea thermophila UNI-1 (GenBank accession number NC_014960) and the single Thermoflexales SAG to that of Thermoflexus hugenholtzii JAD2 (NCBI BioProject PRJNA195829), as they were determined to be their closest respective relatives. The type strain A. thermophila UNI-1 was isolated from an anaerobic granular sludge reactor treating fried soybean curd manufacturing wastewater in Japan (35), while the type strain T. hugenholtzii JAD2 was isolated from the sediment of Great Boiling Spring in Nevada (36). Both are considered thermophilic, Gram-negative, nonspore-forming, heterotrophic bacteria that grow in multicellular filaments (36, 37).

Phylogenetic analysis. SSU rRNA gene sequences and phylogenetic relatives were aligned using the Silva SINA aligner (38). For the rdhA analysis, amino acids were aligned using ClustalW within Geneious (39, 40). The resulting alignments were manually screened and then used to create a phylogenetic consensus tree using MrBayes within Geneious (41). Parameters included using the HKY85 substitution model, the chain length set at 1,100,000, and a subsampling frequency of 200. Priors were set with an unconstrained branch length. The average nucleotide identity (ANI) was calculated for the SAGs and selected genomes, with the BLAST parameters as previously described (42).

Genome completeness estimates. Genome completeness estimates were determined with BLASTP using predicted amino acid sequences against a set of single-copy core genes (43). To be considered valid, all proteins must have at least 30% identity over at least 30% of the length of the core gene (44). The core gene group is made up of 66 previously established genes belonging to a nonredundant list as examined by gene ontology (GO) annotations (44, 45).

Accession numbers. The SSU rRNA gene sequences obtained from MDA have been submitted to the NCBI GenBank database (accession numbers KT119838 to KT119846). All the SAGs have been made public in the Integrated Microbial Genomes (IMG) database (IMG submission identifiers [IDs] 68650, 69642 to 69645, 69647 to 69649, and 69684).

Acquisition methods are described in the following publication:
Lee, M.D., Walworth, N.G., Sylvan, J.B., Edwards, K.J., and Orcutt, B.N. 2015. Microbial Communities on Seafloor Basalts at Dorado Outcrop Reflect Level of Alteration and Highlight Global Lithic Clades. Front. Microbiol. doi:10.3389/fmicb.2015.01470

In summary (excerpted from above):
Over the span of December 7–23, 2013, 12 seafloor rock samples (11 basalts and 1 lithified carbonate, hereafter R1–R12) were collected from across Dorado Outcrop while aboard R/V Atlantis during cruise AT26-09 following previously developed protocols. Using the ROV Jason II, samples were collected and those for DNA analysis were placed in either sterile whirl-pak bags or centrifuge tubes and frozen at −80 degrees C. In addition to the basalts, two bottom water samples were collected using a Niskin bottle mounted to an elevator, and 1.25 L were filtered onto 0.2 um pore size polycarbonate Nucleopore filters that were then frozen at −80 degrees C.

DNA Extraction and Sequencing of the 16S rRNA Gene
Frozen rock pieces were crushed in a flame-sterilized impact mortar into sand-sized grains which were then transferred to sterile plastic centrifuge tubes and stored at −80 degrees C until DNA extractions were performed. DNA extractions were carried out with the FastDNA Spin Kit for Soil (MP Biomedicals, Santa Ana, CA, USA) following the manufacturer's specifications. About 0.5 g of crushed material were placed directly into the lysis tubes of the kit, as were the bottom water filters. Protocol blanks were performed with each extraction (no samples or DNA added to lysis tubes) to track the potential for contamination. DNA concentrations were quantified with the Qubit HS dsDNA Assay kit with a Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA) according to manufacturer protocols.

DNA extracts from the 12 rock samples (plus one technical replicate from the same sample), one green-colored, potential biofilm sample from R11, two bottom water samples, and four protocol blanks for a total of 20 samples were sent for DNA sequencing by a commercial vendor (Molecular Research LP; MR DNA; Shallowater, TX, USA). Illumina MiSeq paired-end (2 × 300 base pair) tag sequencing was carried out using the Earth Microbiome Project universal primers 515f and 806r, which flank the V4 region of the 16S rRNA gene. Library preparation and sequencing was carried out at the facility. In brief, the 515f/806r PCR primers with 8-base barcodes on the forward primer were used in a PCR reaction with the HotStarTaq Plus Master Mix Kit (QIAGEN:USA, Valencia, CA, USA). Based on their DNA concentrations and molecular weight, multiple samples were pooled together in equal proportions, purified with Ampure XP beads, and then used to prepare the library by following the Illumina TruSeq DNA library preparation protocol.

Sequence Data Analysis
Tag data curation and processing were carried out using mothur v.1.34.4 (Schloss et al., 2009) following the mothur Illumina MiSeq Standard Operating Procedure (Kozich et al., 2013). Refer to Lee et al (2015) for more information including treatment of extraction blanks and OTU filtering.

Clone Library Processing
For the clone library, near full-length contigs were assembled using Geneious v6.1.8 (Kearse et al., 2012). Sequences were oriented and trimmed manually and then screened for chimeras using the online program Decipher version 1.14.4 (Wright et al., 2012). The resulting sequences were used in phylogenetic tree construction and submitted to BLAST (Altschul et al., 1990) to search for nearest cultured neighbors as well as environmental samples.

Accession Numbers
The clone sequences recovered from this project are publicly available through NCBI′s GenBank, accession numbers KT748562–KT748628, and the raw tag data are available through NCBI′s Sequence Read Archive under project accession number SRP063681. Additionally, a fasta-formatted file containing the representative OTU sequences identified is available as a Datasheet 2 in Supplementary Material to Lee et al. (2015).

During IODP leg 317 expedition (JOIDES Resolution), a sediment core was drilled at Site U1352 in 344 m water depth. A total depth of 1927.5 mbsf was cored, spanning the Holocene to late Eocene periods. For this work, core sections were obtained from this site from 3.76 mbsf, 11.60 mbsf, 24.60 mbsf, 345.50 mbsf, and 403.10 mbsf.

RNA was extracted from 16 g of sediment from the Canterbury core samples using the RNA PowerSoil Total RNA Isolation Kit (MoBIO Laboratories, Carlsbad, CA) following a modified manufacturer's protocol. Modifications included: ten cycles of homogenization for 1-minute intervals with 1 minute rest between intervals using a FastPrep benchtop homogenizer (MP Biomedicals, Santa Ana, CA) set to 4.0 m/s and increasing the incubation time to 45 min following the addition of SR4 buffer. Trace DNA was removed by treatment with Turbo DNA-free (Life Technologies, Grand Island, NY) for 60 minutes at 37 degrees C. A final RNA purification step was performed using the MEGAclear kit (Life Technologies, USA). In order to avoid contamination, all manipulations were carried out in a dedicated PCR hood (AirClean Systems, USA) for RNA work. An extraction blank was also carried through the entire procedure to control for kit contamination and served as "negative control". Removal of carry-over DNA in RNA extracts was confirmed by the absence of visible amplification of the V4 hypervariable region of SSU rDNA after 35 cycles of PCR using the RNA extracts as template with key-tagged bacterial primers (Flores et al., 2011). PCR conditions were: 95 degrees C for 2 minutes followed by 35 cycles of 95 degrees C for 15 seconds, 53 degrees C for 45 seconds and 68 degrees C for 45 seconds with a final incubation of 68 degrees C for 3 minutes. Total RNA was used as template for cDNA amplification using the Ovation 3’-DGE System (NuGEN, San Carlos, CA) to obtain an enriched eukaryotic metatranscriptome through selection of polyA transcripts. Double-stranded cDNA was purified using the DNA Clean & Concentrator kit (Zymo Research) as described in the modified user guide (https://www.biolynx.ca/pdf/admin/nu_threedgeuserguide.pdf) provided by NuGEN. The quantity of amplified cDNA was evaluated using a fluorometer (Qubit 2.0, Life Technologies).

RNA was extracted from 20 g of sediment from the Peru Margin and 16 g of the Canterbury Basin core samples using the RNA PowerSoil Total RNA Isolation Kit (MoBIO Laboratories, Carlsbad, CA) following a modified manufacturer’s protocol. Modifications included: ten cycles of homogenization for 1-minute intervals with 1 minute rest between intervals using a FastPrep benchtop homogenizer (MP Biomedicals, Santa Ana, CA) set to 4.0 m/s and increasing the incubation time to 45 min following the addition of SR4 buffer. Trace DNA was removed by treatment with Turbo DNA-free (Life Technologies, Grand Island, NY) for 60 minutes at 37 degrees C. A final RNA purification step was performed using the MEGAclear kit (Life Technologies, USA). In order to avoid contamination, all manipulations were carried out in a dedicated PCR hood (AirClean Systems, USA) for RNA work. An extraction blank was also carried through the entire procedure to control for kit contamination and served as "negative control". Removal of carry-over DNA in RNA extracts was confirmed by the absence of visible amplification of the V4 hypervariable region of SSU rDNA after 35 cycles of PCR using the RNA extracts as template with key-tagged bacterial primers (Flores et al., 2011). PCR conditions were: 95 degrees C for 2 minutes followed by 35 cycles of 95 degrees C for 15 seconds, 53 degrees C for 45 seconds and 68 degrees C for 45 seconds with a final incubation of 68 degrees C for 3 minutes. Total RNA was used as template for cDNA amplification using the Ovation RNA-Seq System V2 kit (NuGEN, San Carlos, CA) that uses random hexamers to initiate reverse transcription. Purification of double stranded cDNA was performed with Agencourt RNAClean XP Purification Beads following the instructions provided by NuGEN. Two replicate extractions and reverse transcriptions were performed per sample. The quantity of amplified cDNA was evaluated using a fluorometer (Qubit 2.0, Life Technologies).

Peru Margin subsurface sediments were sampled on IODP leg 201 site 1229A (10°58.5721’ S 77°57.4590’W) in 150.5 m water depth. Core depth at 1229A was 187 mbsf.

DNA was extracted from either 2 or 20 grams of exterior and interior core sediment from frozen (stored at -80 degree C) Peru Margin samples collected at 6 mbsf (2H2) and 95 mbsf (11H5), respectively, using the PowerSoil DNA Isolation Kit (MoBio Laboratories, USA). Extractions were also performed for replicate samples collected from the exterior of both cores. The manufacturer’s protocol was modified to include five repetitions of homogenization for 1-minute intervals, with 1 minute rest in between, using a FastPrep benchtop homogenizer (MP Biomedicals, Santa Ana, CA) set to 4.0 m/s. A final purification step using isopropanol precipitation was also added. Duplicate extractions were performed for both interior and exterior regions of each core. Partial small-subunit ribosomal DNA (SSU rDNA) fragments were PCR amplified from DNA extracts using the key-tagged fungal-targeting primer set nu-SSU-0817-5’ and nu-SSU-1196-3’ (Borneman and Hartin, 2000). Replicate PCR amplifications (3-6) were run for each sample using Phusion High-Fidelity DNA Polymerase (ThermoFisher Scientific, USA) and 5X Phusion HF Buffer. PCR conditions were: 98 degrees C for 30 seconds followed by 40 cycles of 98 degrees C for 10 seconds, 56 degrees C for 30 seconds, and 72 degrees C for 30 seconds, and a final incubation for 7 minutes at 72 degrees C. PCR products were visualized by agarose gel electrophoresis and positive results were excised and purified from the gel using the ZymoClean Gel DNA recovery Kit (Zymo Research, USA). Purified replicate PCR amplifications from each sample were combined prior to iTAG sequencing using Illumina MiSeq PE300 at Georgia Genomics Center.

Samples were collected with SCUBA divers at Cape Lookout Bight, North Carolina (34.6205°N, 76.5500°W), October 2, 2013. Thirty 20 cm PVC push cores were collected, capped, refrigerated, and then returned to the lab on ice in Tennessee within 48 hrs. Bubbles of methane were released from the sediments as each core was taken, indicating the presence of methane at the surface of the core. Using a plunger inserted from the bottom the first three centimeters of sediment taken from each core was placed in a 2L Erlenmeyer flask by way of a funnel. About ten core tubes were needed to fill each of the three flasks to 1.5 liters of sediment. About 100 ml of slurried sediment were autoclaved and incubated alongside the experiments under anoxic conditions as a negative control. Cell counts, hydrogen, sulfate, and methane were measured for the negative control on day 260.  All measurements described below were performed for 18 weekly timepoints for all three incubations (0-122 days). An additional timepoint at 802 days was taken for 16S rRNA gene sequence analysis only.

Geochemistry

Each of the three flasks was fitted with a custom butyl rubber stopper with a hole drilled through the center to accommodate a wide bore (6 mm) glass and Teflon stopcock for the removal of samples. Two 18-gauge needles with stainless steel stopcocks were inserted into the stopper as well. Using the luer-lock fitting on the needles, ultra high purity nitrogen gas (99.999%) that had been scrubbed of oxygen using heated copper fillings was flowed through the bottles using the second needle for the outflow to make the headspace anoxic. Incubation 3 was then flushed with ≥ 99.0% methane gas (Sigma-Aldrich, St. Louis, MO). Then all the ports were closed and the flasks inverted so that sediment covered the gas ports, stopper, and stopcock, and placed in a ring stand at constant room temperature (21.4°C) in the dark.

The incubations were turned over once every seven days just before sampling. Prior to gas sampling, 2 ml of anoxic N2 gas (99.999%) was used to blow the needle clear of sediment. Hydrogen and methane gas samples were collected in glass gastight Hamilton syringes using the steel needle ports in the custom stopper. About 32 ml of sediment was removed through the glass and Teflon stopcock using a sterile 60 ml plastic catheter tip syringe. From this, two 15ml conical centrifuge tubes were filled and capped, one used for porewater analysis and the other frozen at -80°C for later molecular analysis. One ml of sediment was placed in a 2 ml screw cap tube to be fixed and used for cell counts as described below. After sampling, 30ml of oxygen- and hydrogen-scrubbed N2 was injected into the bottle to replace the lost volume. The 15 ml tube destined for porewater analysis was centrifuged at 5000 xG for 5 minutes. A syringe was used to remove the supernatant not in contact with the air. The porewater was then filtered using a 0.2 μm syringe filter into 100 μl of 10% HCl to a final volume of 1 ml. Porewater sulfate content was determined by ion chromatography (Dionex, Sunnyvale, CA), with the remaining porewater used for determining the pH.

500µl of headspace gas was injected into a Peak Performer 1 Reducing Compound Photometer (Peak Laboratories, Mountain View, CA). Premixed hydrogen ppm lab bottles (Sigma-Aldrich, St. Louis, MO) were used as standards. Hydrogen was assumed to be equilibrated between headspace and porewater, since the equilibration time for Cape Lookout Bight sediments is < 2 days (Hoehler et al. 1998), which is less than the 7 days between timepoints in our study. Therefore, gas phase partial pressures were converted to aqueous hydrogen concentrations using the solubility coefficient of hydrogen corrected for salinity of 35 ppt and temperature of 21.4°C (Crozier & Yamamoto 1980). Methane was determined by using injected 500 µl of gas from the headspace into an evacuated glass bottle to be later analyzed on a gas chromatograph with a flame ionized detector (Agilent, Santa Clara, CA). Methane concentrations were not assumed to be equilibrated with the aqueous phase, therefore concentrations are presented as partial pressures.

Cell quantification

Total cell counts were determined by direct epifluorescence microscopy SYBRGold DNA stain (Invitrogen, Carlsbad, CA). Sediments were sonicated at 20% power for 40 seconds to disaggregates cells from sediments and diluted 40-fold into PBS prior to filtration onto a 0.2 μm polycarbonate filter (Fisher Scientific, Waltham, MA) and mounted onto a slide. An autoclaved sediment sample was used as a negative control.

Quantitative PCR

DNA was extracted from sediment samples frozen at -80°C using the Fast DNA kit for Soil (MP Bio, Santa Ana, CA). Negative controls of sterilized sediment and a blank water extract were used as well. Quantitative PCR was used to determine 16S rRNA gene copy numbers of several taxa with Quantifast SYBRGreen kit (Qiagen) on a BioRad IQ5 machine. DNA standards were prepared from either existing stocks (Lloyd et al., 2011) or from TOPO plasmids (Invitrogen, Carlsbad, CA) containing PCR amplified 16S rRNA gene products of closely related relatives in the clades Methanomicrobiales and Methanosarcinales synthesized by Invitrogen (accession # AB236118 and AB679168 respectively). Standards were quantified using Hoechst dye in a flourimeter (Hoefer, Holliston, MA). 16s rRNA specific primers Methanomicrobiales and Methanosarcinales primers were selected to have good coverage of the taxa (Narihiro and Sekiguchi, 2011).

16S Ribosomal RNA Gene Amplicons

Extracted DNA was used for 16S rRNA gene amplicon analysis. The V4 region of each DNA extraction was amplified using primers 806r and 515f (Caporaso et al., 2012), as a universal primer pair for Bacteria and Archaea. Library preparations via Nexterra kit and sequencing using an Illumina MiSeq were performed at the Center for Environmental Biotechnology at the University of Tennessee in Knoxville. The Mothur MiSeq Standard Operating Procedure was used to make contigs of bidirectional sequences, cluster operational taxonomic units (OTUs) at 97% similarity, and classify them with the Silva reference set 119 (Schloss et al., 2009, Pruesse et al., 2007). 26.4% of unique sequences were removed as chimeric and then approximately 5% of total sequences were removed for failing to classify at the domain level. Reads were normalized against the sum of reads classified as bacteria and archaea.

Analyses of time course patterns of various microbial taxa were considered only for those with more than 20 reads when summed from the 18 timepoints from each of the three incubations, leaving between 593 and 669 genus-level clades of bacteria and archaea across the three incubations. Total reads ranged from 20,922 to 329,380 for the 54 libraries. 16S rRNA sequences were normalized to total classifiable bacterial and archaeal reads. ]

Sampling and Analytical Methodology:
Genomic DNA was extracted from Baltic Sea Basin sediments using FastDNA® Spin Kit for Soil
(MP Biomedicals). 16S rRNA gene copy numbers of targets were quantified with qPCR using the
primers in the table in datasheet. Results of qPCR were rejected if the R2 of the standard curve was
below 0.95, or if the melt curve showed evidence of primer dimers. SYBR green chemistry was used
for all reactions, and Invitrogen mastermix was used for DNA copy number measurement on a
BioRad iQ5 (Applied Biosystems, Foster City, California). Serial dilutions of full-length 16S rRNA
gene PCR products from plasmids containing amplified partial 16S genes were used as standards.

Primers Used:

Primer name     Sequence (5' - 3')           Target          Reference
Bac340f         TCCTACGGGAGGCAGCAGT          Bacteria        Nadkarni et al., 2002
Bac 515r        CGTATTACCGCGGCTGCTGGCAC      Bacteria        Nadkarni et al., 2002
Arch915f        GTGCTCCCCCGCCAATTCCT         Archaea         Kubo et al., 2012
Arch1059r       GCCATGCACCWCCTCT             Archaea         Kubo et al., 2012
ANME1-628f      GCT TTC AGG GAA TAC TGC      ANME-1          Lloyd et al., 2011
ANME1-830r      TCG CAG TAA TGC CAA CAC      ANME-1          Lloyd et al., 2011
MCG528f         CGGTAATACCAGCTCTCCGAG                        Kubo et al., 2012
MCG732r         CGCGTTCTAGCCGACAGC                           Kubo et al., 2012

Primers used from the following publications:
Archaea of the Miscellaneous Crenarchaeotal Group are abundant, diverse and widespread in marine sediments

Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set

Environmental evidence for net methane production and oxidation in putative ANaerobic MEthanotrophic (ANME) archaea

A proteomic profile of the chemolithoautotrophic, neutrophilic, iron-oxidizing Mariprofundus ferrooxydans was obtained in duplicates and analyzed via LC-MS/MS. Additionally, a proteomic analysis of the membrane fraction is included. Cultures were harvested at late log phase by following the protocol in Barco and Edwards (2014). Briefly, proteins were extracted with 0.1N NaOH/2% SDS solution, clarified and concentrated by nanofiltration. The concentrated samples were run on SDS-PAGE gels in duplicate lanes. All the bands from each lane were excised and analyzed via LC-MS/MS. Membrane fractions were obtained in the following way: the cell-separation protocol was performed per Barco and Edwards (2014) and the cell pellet was resuspended in 0.5M NaCl/40mM Tri-base buffer at pH 8.5 and sonicated for 10 cycles of 30 secs pulses followed by 30 secs of cooling. This sample was clarified and the supernatant was ultracentrifuged at 100,000 x g for 2 hrs. The reddish pellet was solubilized with 0.5% Ultrol Grade, n-Dodecyl-beta-D-maltoside and run on a SDS-PAGE gel. DNA: DNA was extracted by using the FastDNA Spin soil kit according to the manufacturer’s instructions (MP Biomedicals). Extracted DNAwas stored at 20 degrees C until processing. Genomic gaps were amplified by PCR on a Veriti thermal cycler (Life Technologies) as follows: 1 step of denaturation at 95 degrees C for 4 min; 35 cycles of denaturation, melting, and extension (95 degrees C for 30 s, 51 degrees C for 30 s, and 72 degrees C for 3 min, respectively); 1 step of extension at 72 degrees C for 10 min; and 1 final step of cooling at 4 degrees C. Primers used for the gap containing the Cyc1PV-1 gene were 79F (5'-GAAGCGATGGGAAATGTGAAT-3') and 375F (5'-CACACTGGAAGATGTTCTGG-3'). Primers used for the gap containing the Cyc2PV-1 gene were 555F (5'-ACTGATGGGTATCAACAACC-3') and 92R (5'-CCTATCTGTACCGAGCATTC-3'). The amplicons were purified by using the QIAquick PCR purification kit (Qiagen). Amplicon sizes were checked in a 1% agarose gel via electrophoresis. Purified PCR amplicons were submitted for Sanger sequencing and primer walking (Laragen).

Samples were acquired by the scientific drilling vessel JOIDES Resolution at IODP Site U1385A (37°34.285'N, 10°7.562'W) on November 25th, 2011 by Advanced Piston Coring (APC). Whole-round sections meant for molecular analysis were immediately frozen at -80 degrees C for the remainder of the cruise and shipped at this temperature. DNA was extracted using the MO BIO PowerMax Soil DNA Isolation Kit (MO BIO Laboratories Inc., Carlsbad, CA, USA) with a minor adjustment to manufacturer’s protocol. Briefly, 10 g of sediment extruded from the interior (>1cm from core liner) of whole-round core samples was processed according to manufacturer’s instructions, save for an additional step of incubation in a 65 degree C water bath for 15 minutes prior to step 4 (10 minute vortex). Extractions did not yield enough genomic DNA for direct Illumina library preparation. Thus, 2 ng of genomic DNA from each sample was added to the GenomePlex Whole Genome Amplification (WGA) kit (Sigma-Aldrich, Inc., St. Louis, MO, USA). Reactions were run for 20 cycles at manufacturer suggested denaturing and annealing temperatures. Triplicate reactions were pooled and products were purified using the GenElute PCR Clean-Up kit (Sigma-Aldrich Inc., St. Louis, MO, USA). Samples were sent for Illumina library preparation and 2 x 150 bp paired-end-sequencing was performed on 2 lanes of a Illumina HiSeq2500 machine at the University of Delaware Sequencing and Genotyping Center in the Delaware Biotechnology Institute according to manufacturer’s instructions. Over 85,000,000 reads were generated across 6 samples.

Samples were acquired by the scientific drilling vessel JOIDES Resolution at IODP Site U1385A (37°34.285'N, 10°7.562'W) on November 25th, 2011 by Advanced Piston Coring (APC). Whole-round sections meant for molecular analysis were immediately frozen at -80 degrees C for the remainder of the cruise and shipped at this temperature. DNA was extracted using the MO BIO PowerMax Soil DNA Isolation Kit (MO BIO Laboratories Inc., Carlsbad, CA, USA) with a minor adjustment to manufacturer’s protocol. Briefly, 10 g of sediment extruded from the interior (>1cm from core liner) of whole-round core samples was processed according to manufacturer’s instructions, save for an additional step of incubation in a 65 degree C water bath for 15 minutes prior to step 4 (10 minute vortex). RNA was extracted using a modified protocol of the FastRNA Pro Soil-Direct Kit (MP Biomedicals, Solon, OH, USA) as described in Orsi et al. 2013b. 20 grams of thawed sediment was extracted from the center of each core whole-round sample and 5 grams placed in each of four 15 ml conical tubes. 5 mls of RNA soil lysis solution was added to each tube and vortexed for ~30 seconds. Additional soil lysis solution was added until ~ 1 ml of headspace remained. Tubes were then placed on a homogenizer (MP Biomedicals, Solon, OH, USA) and homogenized at a speed setting of 4.5 for 60 seconds. Two 15 ml tubes were combined into 50 ml conical tubes and centrifuged at 4000 rpm for 20 minutes. Supernatants were combined into one 50 ml tube. Roughly one- tenth volume of 2M sodium acetate pH 4.0 and 1 volume of phenol:chloroform pH 6.5 was added and samples were vortexed for 15 seconds and incubated at room temperature for 5 minutes. Samples were then centrifuged for 20 minutes at 4000 rpm. The top phase was removed to a new 50 ml tube. A roughly one-tenth volume of the kit’s inhibitor removal solution was added and samples were again centrifuged for 5 minutes at 4000 rpm. Supernatant was poured into a new tube and 2.5 volumes of 100% molecular grade ethanol and one-tenth volume of 3M sodium acetate was added. Tubes were then briefly vortexed and allowed to precipitate overnight at -80 degrees C.

The next day, samples were spun down for 60 minutes at 4000 rpm at 4 degrees C. An additional treatment with phenol:chloroform and inhibitor removal solution was performed before a 1 hour precipitation with 100% isopropanol at -20 degrees C. Samples were centrifuged at 14,000 rpm for 20 minutes and pellet was washed with 70% ethanol and centrifuged again. Pellet was allowed to air dry and was resuspended in 200 μl of RNAse free water. A one-tenth volume of Turbo DNAse buffer (Life Technologies, Carlsbad, CA, USA) and 1 ul of Turbo DNAse was added and incubated at 37 degrees C to get rid of contaminating DNA. Tubes were centrifuged at 14,000 rpm for 2 minutes and supernatant was aspirated into a new RNAse free 1.5 ml tube. The FastRNA Pro Soil-Direct kit instructions were then followed to the end, starting at step 18 (RNA matrix/slurry step) and including the optional "centrifugation through quick- clean filters" step. PCR using DNA polymerase with 2 ul of RNA as template was performed to check for left over contaminating DNA. No DNA-based PCR product was seen (data not shown). DNA extracts (including an extraction blank) were amplified using primers for the V4 hypervariable region of the eukaryotic 18S rRNA gene (Orsi et al. 2013a). PCR was performed for 35 cycles using SpeedSTAR HS DNA polymerase (Clontech Laboratories Inc., Mountain View, CA, USA) at an annealing temperature of 63 degrees C. Reactions were performed in three separate 25 ul aliquots and pooled. Reactions were checked by gel electrophoresis and product was gel-purified using the Wizard SV Gel and PCR Cleanup system (Promega Corporation, Madison, WI, USA). Concentrations were checked via Qubit v2.0 (Life Technologies, Carlsbad, CA, USA) and equimolar aliquots of product were sent to Molecular Research LP (Shallowater, TX, USA) for barcoding and sequencing on Illumina MiSeq platform per manufacturer's instructions.

For RNA extracts (including an extraction blank), amplicons were generated with the Superscript One-Step RT-PCR system with Platinum Taq DNA polymerase (Life Technologies, Grand Island, NY, USA) using pre-barcoded primers for the V4 hypervariable region of the eukaryotic 18S rRNA gene (Orsi et al. 2013a, same core primers used for DNA amplicons). The cDNA synthesis was performed at 50 degrees C for 30 minutes, followed by 35 cycles of PCR amplification according to the manufacturer's thermocycling protocol. Triplicate 50 ul RT-PCR reactions were pooled and checked for product via gel electrophoresis. RT-PCR products were gel purified using the QIAquick Gel Purification kit (Qiagen, Netherlands) and quantified via Qubit v2.0. Equimolar quantities of barcoded RT-PCR amplicons were pooled and sent for 454 pyrosequencing with FLX Titanium chemistry according to manufacturer's instructions at Selah Genomics (Greenville, South Carolina, USA).

DNA extraction and purification

DNA was extracted, in duplicate, from 8 to 20 g of “Mobio” IODP sediment samples previously frozen at -80C using a Powersoil total RNA Isolation Kit with the DNA Elution Accessory Kit (MO-BIO Laboratories, Solana Beach, CA, USA) following the manufacturer protocol but without beads. Approximately 2 grams of sediments were utilized for each extraction, and DNA pellets from each depth were pooled together. DNA concentrations were measured using a Qubit 2.0 fluorometer with dsDNA High Sensitivity reagents (Invitrogen, Grand Island, NY, USA). The DNA from the extractions that yielded robust 16S rRNA and metagenomic sequences ranged from 3.75-15 ng of DNA per gram of sediments.

16s rRNA gene PCR and amplicon sequencing

The V4 hypervariable region of the 16S rRNA gene was amplified from extracted DNA with barcoded Illumina-specific adapters (38) with technical replication. DNA template (2 ng) was mixed with 5 uL of 10x Taq Mutant reaction buffer, 0.4 uL of Klentaq LA Taq Polymerase (DNA Polymerase Technology, St. Louis, MO, USA), 2 uL of 10 mM dNTP mix (Sigma Aldrich, St. Louis, MO, USA), 2 uL of reverse and forward V4-specific primers F515 and R806 (39) and the remainder DNA-free water to 50 uL (Ambion, Grand Island, NY, USA). PCR was performed on a Bio-Rad C1000 Touch thermal cycler (Bio-Rad, Hercules, CA, USA) with the following conditions: initial denaturation at 94oC (5 min), followed by 35 cycles of denaturation at 94oC (40 s), primer annealing at 55oC (40 s) and primer extension at 68oC (30 s). The ~400 bp PCR size fragment was confirmed on a 1% agarose gel and replicated samples were pooled. A 50 uL fraction of each pooled sample was purified using a QIAquick PCR Purification Kit (Qiagen, Germantown, MD, USA).  Barcoded amplicons for each sample were pooled in equimolar concentrations and sequenced on an Illumina MiSeq (School of Biology, Georgia Institute of Technology), running MiSeq Control Software v.2.4.0.4, using MiSeq reagent kit v2 (500 cycles) with 5% PhiX genomic library control. 

DNA extraction and purification

DNA was extracted, in duplicate, from 8 to 20 g of of “Mobio” IODP sediment samples previously frozen at -80C  using a Powersoil total RNA Isolation Kit with the DNA Elution Accessory Kit (MO-BIO Laboratories, Solana Beach, CA, USA) following the manufacturer protocol but without beads. Approximately 2 grams of sediments were utilized for each extraction, and DNA pellets from each depth were pooled together. DNA concentrations were measured using a Qubit 2.0 fluorometer with dsDNA High Sensitivity reagents (Invitrogen, Grand Island, NY, USA). The DNA from the extractions that yielded robust 16S rRNA and metagenomic sequences ranged from 3.75-15 ng of DNA per gram of sediments.

Multiple Displacement Amplification (MDA)

DNA was amplified using a REPLI-g Single Cell Kit (Qiagen, Germantown, MD, USA). Tubes, tube caps and reverse transcription-PCR grade water (Ambion, Grand Island, NY, USA) were UV-treated for 15 min in a PCR laminar flow hood. Quantitative PCR showed that the negative control began amplifying after 5 hr of incubation at 30°C, and therefore, the 30°C incubation step was shortened to 5 hr using a Bio-Rad C1000 Touch thermal cycler (Bio-Rad, Hercules, CA, USA). DNA concentrations were measured in duplicate on a Qubit 2.0 with dsDNA High Sensitivity reagents (Invitrogen, Grand Island, NY, USA).

Illumina library preparation and sequencing

Two micrograms of MDA DNA were used to generate genome libraries using a TruSeq DNA PCR-Free Kit following the manufacturer’s protocol (Illumina, San Diego, CA, USA). The resulting libraries were sequenced using a Rapid-Run on an Illumina HiSeq 2500 (Center for Integrative Genomics, Georgia Institute of Technology) to obtain 100 bp paired-end reads

All methodology can be located in the reference:
Tully and Heidelberg 2013. Microbial communities associated with ferromanganese nodules and the surrounding sediments. Frontiers in Microbiology. 4(161). doi:10.3389/fmicb.2013.00161

In summary (refer to publication above for complete description of methodology):
Sediment and FeMn nodules were collected during Expedition Knox-02RR (December 2006–January 2007 aboard the R/V Roger Revelle). Extraction of DNA from nodules proceeded using a modified phenol-chloroform extraction method. Due to low yield using the described phenol-chloroform method, extraction of DNA from sediment samples was performed using the MoBio PowerLyzer PowerSoil DNA kit following the manufacturer's protocol. All samples with >0.1 ng/uL final DNA concentration were cleaned and concentrated and samples were resuspended in 20 uL of sterile, DNase-free H2O. Samples were amplified using PCR, targeting the V4 region of the 16S rRNA gene. All amplifications were performed using the FastStart High Fidelity PCR System (Roche). Initial PCR products were pooled and the PCR product (~550 bp) was gel excised using the Qiagen Gel Extraction Kit (Qiagen) following the manufacturer's protocol. Excised DNA products were amplified in duplicate to generate sufficient material for pyrosequencing. PCR products were pooled and cleaned using the AMPure Bead XP (Agencourt) kit, following the manufacturer's protocol. Samples were quantified using PicoGreen and visualized using Agilent Bioanalyzer using the High Sensitivity (Agilent) chip.

Sample collection and storage: Subsurface sediment samples from Hydrate Ridge (IODP Leg 204 Site 1244a; 44° 35' 17" N, 125° 07' 19" W), Peru Margin (IODP Leg 201 Site 1227a; 79° 57' 349" W, 08° 59' 463" S), and Eastern Equatorial Pacific (IODP Leg 201 Site 1225a; 110° 43' 289" W, 02° 46' 247" N) were obtained from the Gulf Coast Core Repository (University of Texas A&M). Gravity core subsurface samples from North Pond near the Mid-Atlantic Ridge (22° 48' 04" E, 46° 06' 30" N) and Benguela Upwelling System (14° 15' 04" E, 27° 44' 40" S) were collected on March 3rd 2009 onboard the R/V Maria Merian and April 21st 2008 onboard the R/V Meteor, respectively and were provided by Andreas Teske (University of North Carolina, Chapel Hill, NC). Careful precautions were taken during sampling to avoid contamination during the sampling process. For IODP cores, contamination tests were performed using Perfluorocarbon tracers and fluorescent microspheres. Sediment samples were immediately frozen at −80 degrees C after sampling and stored at −80 degrees C until RNA was extracted. Sediment samples at a sediment depth of 0.01 and 0.08 mbsf from Little Sippewissett Salt Marsh were taken November 13th 2011 using a sterile syringe. Sulfide was detectable in both samples and thus samples were presumed anoxic. No specific permits were required for the described field studies. The locations sampled are not privately owned or protected and field studies did not involve endangered or protected species.

RNA extraction and purification: RNA was extracted from 25 grams of sediment using the FastRNA Pro Soil-Direct Kit in a laminar flow hood to reduce contamination from aerosols. Extractions were performed at Woods Hole Oceanographic Institution. Several modifications were made to the protocol provided with the kit to increase RNA yield from low biomass subseafloor samples. It was necessary to scale up the volume of sediment that is typically extracted with the kit (~0.5 grams) due to the expected low biomass of subsurface eukaryotes. Four 15 ml Lysing Matrix E tubes (MP Biomedicals, Solon, OH) were filled with 5 g sediment and 5 ml of Soil Lysis Solution. Tubes were vortexed to suspend the sediment and Soil Lysis Solution was added to the tube leaving 1 ml of headspace. Tubes were then homogenized for 60 seconds at a setting of 4.5 on the FastPrep-24 homogenizer. Contents of the 15 ml tubes were combined into two RNAse free 50 ml falcon tubes and centrifuged for 30 minutes at 4000 RPM. The supernatants were combined in a new 50 ml RNAse-free falcon tube and 1/10 volume of 2M Sodium Acetate (pH 4.0) was added. An equal volume of phenol-chloroform (pH 6.5) was added and vortexed for 30 seconds, incubated for 5 minutes at room temperature, and centrifuged at 4000 RPM for 20 minutes at 4 degrees C. The top phase was carefully transferred to a new 50 ml falcon tube and 2.5x volumes 100% ethanol and 1/10 volume 3M Sodium Acetate were added and incubated overnight at −80 degrees C. After incubation, tubes were centrifuged at 4000 RPM for 60 minutes at 4 degrees C and the supernatant removed. Pellets were washed with 70% ethanol, centrifuged for 15 minutes at 4 degrees C, and air-dried. Dried pellets were resuspended with 0.25 ml RNAse-free sterile water and combined into a new 1.5 ml RNAse-free tube. 1/10 volume of 2M Sodium Acetate (pH 4.0) and an equal volume of phenol:chloroform (pH 6.5) were added, the tube was vortexed for 1 minute, and incubated for 5 minutes at room temperature. The tube was then centrifuged for 10 minutes at 4 degrees C, the top phase removed into a new RNAse free 1.5 ml tube, and 0.7 volumes of 100% isopropanol was added and incubated for 1hour at −20 degrees C. After incubation tubes were centrifuged for 20 minutes at 14000 RPM at 4 degrees C and the supernatant was removed. Pellets were washed with 70% ethanol and centrifuged at 14000 RPM for 5 minutes at 4 degrees C. Ethanol was removed and the pellets air-dried. Pellets were resuspended with 200 ul of RNAse free sterile water and DNA was removed using the Turbo DNA-free kit (Life Technologies, Grand Island, NY). DNAse incubation times were increased to 1 hour to ensure removal of contaminating DNA. Samples were then taken through the protocol supplied with the FastRNA Pro Soil-Direct kit to the end (starting at the RNA Matrix and RNA Slurry addition step), including the optional column purification step to remove residual humic acids. To further purify the RNA, we used the MEGA-Clear RNA Purification Kit. Extraction blanks were performed (adding sterile water instead of sample) to identify aerosolized contaminants that may have entered sample and reagent tubes during the extraction process. To reduce contamination, all RNA extractions were performed in a laminar flow hood.

RT-PCR amplification of eukaryotic rRNA: To amplify the V4 hypervariable region of eukaryotic rRNA, we used PCR primers targeting this region: EukV4F (5' – CGTATCGCCTCCCTCGCGCCATCAGxxxxxxxxxxCCAGCASCYGCGGTAATTCC – 3') and EukV4R (5' – CTATGCGCCTTGCCAGCCCGCTCAGACTTTCGTTCTTGATYRA – 3'), where the x region represents the unique MID barcode used for each sample, the linker primer sequence is underlined, and the 18S rRNA eukaryotic primer is bold. These primers were chosen because they target a wide range of eukaryotic taxa. RT-PCR was performed using the SuperScript One-Step RT-PCR with Platinum Taq kit. Individual reactions consisted of 2 ul RNA template, 25 ul buffer, 1 ul of forward Primer, 1 ul of reverse primer, 2 ul of the Platinum RT-Taq enzyme mix, and 18 ul RNAse free sterile water. The cDNA step was performed at 55 degrees C and cDNA was amplified in 40 cycles of PCR with an annealing temperature of 65 degrees C (55 degrees C for 30 minutes, 95 degrees C for 5 minutes, [95 degrees C for 15 seconds, 65 degrees C for 30 seconds, 68 degrees C for 1 minute]x40, 68 degrees C for 5 minutes). To check for DNA carryover during the RNA extraction protocol, a separate PCR reaction (at the same number of cycles) was included in which Taq polymerase was substituted for the reverse-transcriptase/platinum Taq enzyme mix. For each sample, 5–10 RT-PCR reactions were performed and extracted using the Zymo Research Gel Extraction Kit. A gel volume of 100% isopropanol was added to each dissolved gel slice before addition to the DNA collection column. Dissolved gel slices from each sample were pooled by centrifuging them all through the same DNA collection column. cDNA was quantified fluorometrically prior to 454 sequencing using the Qubit 2.0. To identify contaminants we performed additional RT-PCR amplifications at 55 cycles using RNAse free sterile water and RNA extraction blanks (resulting from RNA extractions in which no sample was added) as template. Contaminants were amplified with primers containing a unique MID in 55 cycles of PCR.

Quality control, clustering, and taxonomic assignment of 454 data: cDNA amplicons were sequenced on a GS-FLX Titanium 454 sequencer at EnGenCore (University of South Carolina, Columbia, SC), which resulted in ~37000 reads. To reduce homopolymer errors inherent to 454 sequencing, the dataset was put through the denoise protocol as described in the QIIME software package using the denoise_wrapper.py command. After denoising, chimeric sequences were identified and removed using ChimeraSlayer with the blast_fragments method in QIIME. The data were subjected to quality score filtering using the split_libraries.py command and clustered at various levels of sequence identity (80%, 85%, 90%, 93%, 95%, 97%) in QIIME using the uclust method of all-to-all pair-wise comparisons via the pick_otus.py command.

The QIIME taxonomy classification pipeline was not able to accurately classify the majority of eukaryotic OTUs. Thus, we used Jaguc, a program developed specifically for classification of eukaryotic rRNA sequence data, to classify our sequence reads. 90% of eukaryotic OTUs were classified to genus using this approach. OTU tables were created using the make_otu_table.py command in QIIME and the Jaguc taxonomy for each OTU was amended onto this table using a custom perl script developed by the authors for this purpose. This perl script is available from the authors upon request.

Terminal Restriction Fragment Length Polymorphism (TRFLP) analysis of fungal rRNA: To further investigate the fungal diversity in our samples, we used a TRFLP approach using PCR primers specific to fungal 18S rRNA. The fungal primers used were EF3 (5' – TCCTCTAAATGACCAAGTTTG – 3') and Fung5 (5' – GTAAAAGTCCTGGTTCCCC – 3'). The forward primer, EF3, was labeled with the phosphoramidite dye 6-Carboxyfluorescein (6-FAM) at the 5'-end (Integrated DNA Technologies, Coralville, Iowa). Fungal rRNA was amplified using a cDNA incubation step at 50 degrees C followed by 40 cycles of PCR with an annealing temperature of 53 degrees C. Three RT-PCR reactions were performed for each sample, gel extracted, and pooled using the same protocol as above. Fungal rRNA amplicons were digested with three different restriction enzymes: MspI, RsaI, and HhaI (New England Biolabs, Ipswich, MA), for 1 hr at 37 degrees C. These restriction enzymes were chosen because they have been shown to provide statistically significant TRFLP data for interpreting fungal community structure across different samples. Digests were mixed with the Applied Biosystems size marker GS600LIZ and HiDi Formamide in the ratio 1:1:9 and run on an Applied Biosystems 3730 DNA analyzer. Electropherograms were analyzed using the PeakScanner software package (Applied Biosystems, Carlsbad, CA) to identify the size, height, and peak area of each T-RF. T-REX was used to filter out noise from true peaks and to align peaks.

Related references:
The manuscript is at http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0056335

Sample collection and storage:  Subsurface sediment samples from the continental shelf of Peru, Ocean Drilling Program (ODP) Site 1229D (77° 57.4590′ W, 10° 58.5721′ S), were obtained during ODP Leg 201 on 6 March 2002. Careful precautions were taken to avoid contamination during the sampling process. For Integrated Ocean Drilling Program (IODP) cores, contamination tests were performed using perfluorocarbon tracers and fluorescent microspheres. Sediment samples were immediately frozen at −80 degrees C after sampling and stored at −80 degrees C until used for mRNA extractions in this study (10-year storage time at −80 degrees C).

RNA extraction and purification:  Extraction of sub-seafloor RNA was performed according to the protocol described previously. In brief, RNA was extracted from 25 g of sediment using the FastRNA Pro Soil-Direct Kit (MP Biomedicals). It was necessary to scale up the volume of sediment that is typically extracted with the kit (~0.5 g) owing to the low biomass inherent to marine subsurface samples. All tubes, tips and disposables used were certified RNase free and all extraction procedures were performed in a laminar flow hood to reduce aerosol contamination by bacterial and fungal cells/spores. Five 15-ml Lysing Matrix E tubes (MP Biomedicals) were filled with 5 g sediment and 5 ml of Soil Lysis Solution (MP Biomedicals). Tubes were vortexed to suspend the sediment and Soil Lysis Solution was added to the tube leaving 1 ml of headspace. Tubes were then homogenized for 60 s on the FastPrep-24 homogenizer (MP Biomedicals) with a setting of 4.5. Contents were pooled into two 50-ml tubes and centrifuged for 30 min at 4000 r.p.m. (3220g) at room temperature (25  degrees C). Supernatants were combined in a new 50-ml tube and 1/10 volume of 2 M sodium acetate (pH 4.0) was added. An equal volume of phenol-chloroform (pH 6.5) was added and vortexed for 30 s, incubated for 5 min at room temperature, and spun at 4000 r.p.m. (3220g) for 20 min at 4 degrees C. The aqueous phase was transferred to a new 50-ml tube. Nucleic acids were precipitated by adding 2.5 and 1/10 volumes 100% ethanol and 3 M sodium acetate, respectively, and incubating overnight at −80 degrees C. The next day, tubes were spun at 4000 r.p.m. (3220g) for 60 min at 4 degrees C and the supernatant removed. Pellets were washed with 70% ethanol, spun for 15 min at 4 degrees C and air-dried. Dried pellets were resuspended with 0.25 ml RNase-free sterile water and combined into a new 1.5-ml tube. 1/10 volume of 2 M sodium acetate (pH 4.0) and an equal volume of phenol-chloroform (pH 6.5) were added, vortexed for 1 min and incubated for 5 min at room temperature. This was necessary to remove residual organic material (that is, humic acids) resulting from the rather large pellet/precipitate. After centrifuging at 14000 r.p.m. (20817g) for 10 min at 4 degrees C, the top phase was removed into a new 1.5-ml tube. 0.7 volumes of 100% isopropanol was added and incubated for 1 h at −20 degrees C (to precipitate nucleic acids). Tubes were then centrifuged for 20 min at 14000 r.p.m. (20,817g) at 4 degrees C and the supernatant removed. Pellets were washed with 70% ethanol and centrifuged at 14000 r.p.m. (20817g) for 5 min at 4 degrees C. After removing ethanol and air-drying, pellets were re-suspended in 0.2 ml of RNase free sterile water. DNA was removed using the Turbo DNA-free kit (Life Technologies), increasing the incubation time to 1 h to ensure rigorous DNA removal. After this step, samples were taken through the protocol supplied with the FastRNA Pro Soil-Direct kit to the end (starting at the RNA Matrix and RNA Slurry addition step), including the column purification step to remove residual humic acids (see FastRNA Pro Soil-Direct Kit manual). Extraction blanks were performed (adding sterile water instead of sample) to ensure that aerosolized contaminants did not enter sample and reagent tubes during the extraction process. Absence of DNA and RNA contamination was confirmed by no visible amplification of small subunit (SSU) ribosomal RNA (rRNA) and rRNA genes from extraction blanks after 35 cycles of PCR and RT–PCR.

After RNA extraction, the MEGA-Clear RNA Purification Kit (Life Technologies) was used to purify the RNA. This kit removes short RNA fragments (mostly produced during the extraction protocol) and residual inhibitors (that is, humics). We followed the protocol all the way through the optional precipitation/concentration step, re-suspending the RNA pellet in 10 ul of RNase-free sterile water. Before cDNA amplification, the removal of contaminating DNA in RNA extracts was confirmed by the absence of visible amplification of SSU rRNA genes after 35 cycles of PCR using the RNA extracts as template.

cDNA amplification and Illumina sequencing: Five microlitres of purified RNA was used as template for whole-cDNA amplification using the Ovation RNA-Seq v2 System (NuGEN technologies, http://www.nugeninc.com/nugen/index.cfm/products/cs/ngs/rna-seq-v2/). We followed the manufacturer’s instructions for cDNA amplification, and the resulting quantity of cDNA was checked on a Nanodrop (Thermo Scientific) and Fluorometer (Qubit 2.0, Life Technologies). Quality of the amplified cDNA was checked on a Bioanalyzer (Agilent Biotechnologies) before Illumina sequencing. Illumina library preparation and paired-end sequencing was performed at the University of Delaware Sequencing and Genotyping Center (Delaware Biotechnology Institute).

Related references:
For more sampling information see www-odp.tamu.edu/publications/prelim/201_prel/201toc.html
The manuscript is at http://www.nature.com/nature/journal/v499/n7457/full/nature12230.html

Methodology:

EPR: Rock material was collected from the EPR at 9.725 N, 104.16 W (2,674 m depth) aboard the R/V Atlantis using the submarine Alvin (cruise AT11-07, dive 3968) in 2004. DNA was extracted from basalt chips using a phenol-chloroform extraction including a negative control. DNA was amplified using the illustrate GenomiPhi V2 DNA Multiple Displacement Amplification (MDA) kit (GE Healthcare Life Sciences, Pittsburgh, PA, USA). Final DNA samples and the control were sent to the core genomics center at University of Pennsylvania for whole genome shotgun sequencing on a Roche GS-FLX Titanium 454 sequencer (454 Life Sciences, Branford, CT, USA).

Loi'hi: Two seafloor basalt samples (J2-243 R2-F, J-246 R2) were collected from the Lō’ihi Seamount (18.47 N, 155.18 W) at a depth of 5,000 m aboard the R/V Melville using the ROV Jason II in 2006. DNA was amplified using the illustrate GenomiPhi V2 DNA Multiple Displacement Amplification (MDA) kit (GE Healthcare Life Sciences, Pittsburgh, PA, USA). Final DNA samples and the control were sent to the core genomics center at University of Pennsylvania for whole genome shotgun sequencing on a Roche GS-FLX Titanium 454 sequencer (454 Life Sciences, Branford, CT, USA).

Negative control: DNA was extracted from sterile MilliQ water using a phenol-chloroform extraction. DNA was amplified using the illustrate GenomiPhi V2 DNA Multiple Displacement Amplification (MDA) kit (GE Healthcare Life Sciences, Pittsburgh, PA, USA). Final DNA was sent to the core genomics center at University of Pennsylvania for whole genome shotgun sequencing on a Roche GS-FLX Titanium 454 sequencer (454 Life Sciences, Branford, CT, USA).