URL | https://www.bco-dmo.org/dataset/662641 |
---|---|
Download URL | https://www.bco-dmo.org/dataset/662641/data/download |
Media Type | text/tab-separated-values |
Created | October 25, 2016 |
Modified | March 22, 2017 |
State | Final no updates expected |
Brief Description | 16S rRNA gene sequences of cells in marine methane seep sediments |
Acquisition Description
Environmental Sampling and Storage (extracted from Hatzenpichler et. al., 2016)
R/V Atlantis cruise AT-15-68:
Sediment sample #3730 was obtained from Hydrate Ridge South methane seep field (Alvin Dive 4635; push-core 16; 44 deg 34.09 N,125 deg 9.14 W; 775 m water depth; sediment horizon 0–6 cm; 4C in-situ temperature) on 7 August 2010. Sediment was stored underargon headspace in a Mylar bag for 5 wk before being transferred toa 1-L glass bottle with a 1.38 bar 100% methane headspace, which was stored at 4C for ~4 years. Seawater and headspace were exchanged at regular intervals to prevent the accumulation of inhibitory compounds.
MBARI Cruise 2013 “Southern California”
Sediment sample #7142 was collected from Santa Monica Basinon 7 May 2013 (R/V Western Flyer MBARI Cruise 2013; dive 459; push-core 74; 33 deg 47.34 N, 118 deg 40.09 W; 863 m depth; sedimenthorizon 4–6 cm; 4C in situ temperature). The sediment was sealed under argon and stored at 4C. After 40 days of storage, the sediment was suspended in anaerobic natural bottom seawater from the site in an anaerobic chamber (3% H2 in N2) and aliquots were overpressured with 1.5 bar methane. The sediment was kept for 12 months under 1.5 bar 100% methane in natural bottom seawater that was exchanged every 3 mo.
All Sample Handling:
All samples were kept in an ice bath at all times during handling. Artificial seawater (ASW) consisted of 10.9 g of MgCl2·6H2O, 0.2 g of NaHCO3, 0.76 g ofKCl, 25.9 g ofNaCl, 1.47 g of CaCl2·2H2O, 3.98 g of Na2SO4, and 26.73 mg of NH4Cl per liter of ddH2O at pH 7.4. One milliliter of vitamin solution (see medium 141, https://www.dsmz.de) and 1 mL of trace element solution SL- 10 (see https://www.dsmz.de) were also added. Before use, ASW was filtered through a 0.2-μm filter and N2-bubbled for 10 min. ASW was kept on ice during handling. For more information on resuspension and incubation procedures used see Hatzenpichler et. al., 2016.
Processing Description
16S rRNA Gene Tag Sequencing (extracted from Hatzenpichler et. al., 2016)
Sediment DNA was extracted using the Power Soil DNA Isolation Kit according to the manufacturer’s protocol (MoBio), and diluted DNA from genomeamplified sorted consortia was used directly. The V4 region of the 16S rRNA gene was amplified from each extract using archaeal and bacterial primers 515F (GTGCCAGCMGCCGCGGTAA) and 806R (GGACTACHVGGGTWTCTAAT) (67, 68). Sediment samples were amplified in duplicate. The nonbarcoded primers were used with Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs) according to the manufacturer’s directions, using annealing conditions of 54 °C for 30 cycles and 58 °C for 32 cycles for sediments and MDAs, respectively. Duplicates of sediment sample amplifications were then pooled. The barcoded 806R primer (CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXXXX AGTCAGTCAG CC GGACTACHVGGGTWTCTAAT) was paired with 515F in a reconditioning reaction (same conditions as above except for five cycles of PCR) to barcode the PCR products. Samples were mixed together in equimolar amounts and purified in bulk through a Qiagen PCR purification kit before submission to Laragen for analysis on an Illumnia MiSeq platform. The resulting paired-end sequence data, 2× 250 bp, was demultiplexed, and sequences with >1 bp mismatch on the 12-bp barcode were removed. The resulting sequences were passed through Illumina’s MiSeq Recorder software to assign quality scores to each base call and remove adapter, barcode, and primer sequence.
Information on the fluorescence activiated cell sorted microbial aggregate composed of ANME and SRB, and other probe information can be found in Hatzenpichler et. al., 2016
Data Manager Notes:
- several columns in submitted dataset removed and included in metadata such as publication information.
- converted lat/lon from degrees decimal minutes to decimal degrees.
- added underscores in some text fields
- removed units from data colums. Units can be found in the parameters section.
Instruments
Parameters
date; generally reported in GMT as YYYYMMDD (year; month; day); also as MMDD (month; day); EqPac dates are local Hawaii time. ISO_Date format is YYYY-MM-DD (http://www.iso.org/iso/home/standards/iso8601.htm)
Link to an external data entry.
latitude, in decimal degrees, North is positive, negative denotes South; Reported in some datasets as degrees, minutes
longitude, in decimal degrees, East is positive, negative denotes West; Reported in some datsets as degrees, minutes
Water depth at sampling location
water depth, in meters
depth below seafloor. Includes mbsf (meters below seafloor) and cmbsf (centimeters below seafloor).
Dataset Maintainers
Name | Affiliation | Contact |
---|---|---|
Roland Hatzenpichler | Montana State University | ✓ |
Amber York | Montana State University | ✓ |
BCO-DMO Project Info
Project Title | Activity-based cell-sorting and enrichment of newly synthesized proteins via amino acid tagging and click chemistry |
---|---|
Acronym | Cell-sorting and enrichment |
URL | https://www.bco-dmo.org/project/654084 |
Created | August 15, 2016 |
Modified | August 15, 2016 |
Project Description
A fundamental problem faced in deep biosphere research is the low rates at which metabolic activity is occurring in the subsurface. Protein-targeted studies have only rarely been the center of attention, most importantly due to the lack of methodology to visualize protein synthesis within cells and the need for radioactively or stable isotopically labeled substrates to study bulk protein turnover. In response to these limitations, I have recently developed a novel click chemistry-based approach that uses a bioorthogonal non-canonical amino acid to fluorescently track protein synthesis within cells. Within the proposed project I will further develop this method with the goal to establish protocols for the separation and characterization of translationally active cells as well as for the enrichment and identification of newly synthesized proteins. After establishing these techniques using representative pure and co-cultures, I will refine them using enrichments from Hydrate Ridge methane seep sediment. Furthermore, I will study the applicability of other, yet uncharacterized bioorthogonal amino acids to seep sediments as well as >1,700 meters-below-seafloor deep sandstone samples obtained during IODP-expedition 337. This project directly addresses C-DEBI research themes 1, 3, and 4 and will support an early career researcher who has not previously been funded by C-DEBI.
Data Project Maintainers
Name | Affiliation | Role |
---|---|---|
Roland Hatzenpichler | Montana State University | Lead Principal Investigator |