Person: Andrew D. Steen

Abstract

Project Description

Data Project Maintainers

Abstract

Organic carbon in marine sediments is a critical component of the global carbon cycle, and its degradation influences a wide range of phenomena, including the magnitude of carbon sequestration over geologic timescales, the recycling of inorganic carbon and nutrients, the dissolution and precipitation of carbonates, the production of methane and the nature of the seafloor biosphere. Although much has been learned about the factors that promote and hinder rates of organic carbon degradation in natural systems, the controls on the distribution of organic carbon in modern and ancient sediments are still not fully understood. In this review, we summarize how recent findings are changing entrenched perspectives on organic matter degradation in marine sediments: a shift from a structurally-based chemical reactivity viewpoint towards an emerging acceptance of the role of the ecosystem in organic matter degradation rates. That is, organic carbon has a range of reactivities determined by not only the nature of the organic compounds, but by the biological, geochemical, and physical attributes of its environment. This shift in mindset has gradually come about due to a greater diversity of sample sites, the molecular revolution in biology, discoveries concerning the extent and limits of life, advances in quantitative modeling, investigations of ocean carbon cycling under a variety of extreme paleo-conditions (e.g. greenhouse environments, euxinic/anoxic oceans), the application of novel analytical techniques and interdisciplinary efforts. Adopting this view across scientific disciplines will enable additional progress in understanding how marine sediments influence the global carbon cycle.

Abstract

Building on the synthesis of carbon reservoirs in Earth’s subsurface, this chapter focuses on the forms, cycling, and fate of the carbon supporting microbial life in the terrestrial and marine subsurface. As the subsurface is estimated to host a vast reservoir of life on Earth, identifying the carbon compounds that life uses for energy and growth is key to understanding ecosystem functioning in the past and at present, and also for extrapolating these findings to the search for life in the universe. This chapter highlights advances in quantifying small carbon compounds, measuring rates of carbon turnover, and the fate of carbon in the deep biosphere.

Abstract

We applied theoretical and simulation-based approaches to characterize how microbial community structure influences the amount of sequencing effort to reconstruct metagenomes that are assembled from short-read sequences. First, a coupon collector equation was proposed as an analytical model for predicting sequencing effort as a function of microbial community structure. Characterization was performed by varying community structure properties such as richness, evenness, and genome size. Simulations demonstrated that while community richness and evenness influenced the sequencing effort required to sequence a community metagenome to exhaustion, the effort necessary to sequence an individual genome to a target fraction of exhaustion depended only on the relative abundance of the genome and its genome size. A second analysis evaluated the quantity, completion, and contamination of metagenome-assembled genomes (MAGs) as a function of sequencing effort on four preexisting sequence read data sets from different environments. These data sets were subsampled to various degrees of completeness to simulate the effect of sequencing effort on MAG retrieval. Modeling suggested that sequencing efforts beyond what is typical in published experiments (1 to 10 Gbp) would generate diminishing returns in terms of MAG binning. A software tool, Genome Relative Abundance to Sequencing Effort (GRASE), was created to assist investigators to further explore this relationship. Reevaluation of the relationship between sequencing effort and binning success in the context of genome relative abundance, as opposed to base pairs, provides a constraint on sequencing experiments based on the relative abundance of microbes in an environment rather than arbitrary levels of sequencing effort.

Abstract

Widely used microbial taxonomies, such as the NCBI taxonomy, are based on a combination of sequence homology among conserved genes and historically accepted taxonomies, which were developed based on observable traits such as morphology and physiology. A recently proposed alternative taxonomy database, the Genome Taxonomy Database (GTDB), incorporates only sequence homology of conserved genes and attempts to partition taxonomic ranks such that each rank implies the same amount of evolutionary distance, regardless of its position on the phylogenetic tree. This provides the first opportunity to completely separate taxonomy from traits and therefore to quantify how taxonomic rank corresponds to traits across the microbial tree of life. We quantified the relative abundances of clusters of orthologous group functional categories (COG-FCs) as a proxy for traits within the lineages of 13,735 cultured and uncultured microbial lineages from a custom-curated genome database. On average, 41.4% of the variation in COG-FC relative abundance is explained by taxonomic rank, with domain, phylum, class, order, family, and genus explaining, on average, 3.2%, 14.6%, 4.1%, 9.2%, 4.8%, and 5.5% of the variance, respectively (P < 0.001 for all). To our knowledge, this is the first work to quantify the variance in metabolic potential contributed by individual taxonomic ranks. A qualitative comparison between the COG-FC relative abundances and genus-level phylogenies, generated from published concatenated protein sequence alignments, further supports the idea that metabolic potential is taxonomically coherent at higher taxonomic ranks. The quantitative analyses presented here characterize the integral relationship between diversification of microbial lineages and the metabolisms which they host.

Abstract

A recent paper by Martiny argues that “high proportions” of bacteria in diverse Earth environments have been cultured. Here we reanalyze a portion of the data in that paper, and argue that the conclusion is based on several technical errors, most notably a calculation of sequence similarity that does not account for sequence gaps, and the reliance on 16S rRNA gene amplicons that are known to be biased towards cultured organisms. We further argue that the paper is also based on a conceptual error: namely, that sequence similarity cannot be used to infer “culturability” because one cannot infer physiology from 16S rRNA gene sequences. Combined with other recent, more reliable studies, the evidence supports the conclusion that most bacterial and archaeal taxa remain uncultured.

Abstract

Anoxic subsurface sediments contain communities of heterotrophic microorganisms that metabolize organic carbon at extraordinarily slow rates. In order to assess the mechanisms by which subsurface microorganisms access detrital sedimentary organic matter, we measured kinetics of a range of extracellular peptidases in anoxic sediments of the White Oak River estuary, NC. Nine distinct peptidase substrates were enzymatically hydrolyzed at all depths. Potential peptidase activities (V_max) decreased with increasing sediment depth, although V_maxexpressed on a per cell basis was approximately the same at all depths. Half-saturation constants (K_m) decreased with depth, indicating peptidases that functioned more efficiently at low substrate concentrations. Potential activities of extracellular peptidases acting on molecules that are enriched in degraded organic matter (D-phenylalanine and L-ornithine) increased relative to enzymes that act on L-phenylalanine, further suggesting microbial community adaptation to access degraded organic matter. Nineteen classes of predicted, exported peptidases were identified in genomic data from the same site, of which genes for class C25 (gingipain-like) peptidases represented more than 40% at each depth. Methionine aminopeptidases, zinc carboxypeptidases, and class S24-like peptidases, which are involved in single-stranded DNA repair, were also abundant. These results suggest a subsurface heterotrophic microbial community that primarily accesses low-quality detrital organic matter via a diverse suite of well-adapted extracellular enzymes.

Abstract

Energy-starved microbes in deep marine sediments subsist at near-zero growth for thousands of years, yet the mechanisms for their subsistence are unknown because no model strains have been cultivated from most of these groups. We investigated Baltic Sea sediments with single-cell genomics, metabolomics, metatranscriptomics, and enzyme assays to identify possible subsistence mechanisms employed by uncultured Atribacteria, Aminicenantes, Actinobacteria group OPB41, Aerophobetes, Chloroflexi, Deltaproteobacteria, Desulfatiglans, Bathyarchaeota, and Euryarchaeota marine group II lineages. Some functions appeared to be shared by multiple lineages, such as trehalose production and NAD⁺-consuming deacetylation, both of which have been shown to increase cellular life spans in other organisms by stabilizing proteins and nucleic acids, respectively. Other possible subsistence mechanisms differed between lineages, possibly providing them different physiological niches. Enzyme assays and transcripts suggested that Atribacteria and Actinobacteria group OPB41 catabolized sugars, whereas Aminicenantes and Atribacteria catabolized peptides. Metabolite and transcript data suggested that Atribacteria utilized allantoin, possibly as an energetic substrate or chemical protectant, and also possessed energy-efficient sodium pumps. Atribacteria single-cell amplified genomes (SAGs) recruited transcripts for full pathways for the production of all 20 canonical amino acids, and the gene for amino acid exporter YddG was one of their most highly transcribed genes, suggesting that they may benefit from metabolic interdependence with other cells. Subsistence of uncultured phyla in deep subsurface sediments may occur through shared strategies of using chemical protectants for biomolecular stabilization, but also by differentiating into physiological niches and metabolic interdependencies.

Abstract

To describe a microbe’s physiology, including its metabolism, environmental roles, and growth characteristics, it must be grown in a laboratory culture. Unfortunately, many phylogenetically novel groups have never been cultured, so their physiologies have only been inferred from genomics and environmental characteristics. Although the diversity, or number of different taxonomic groups, of uncultured clades has been studied well, their global abundances, or numbers of cells in any given environment, have not been assessed. We quantified the degree of similarity of 16S rRNA gene sequences from diverse environments in publicly available metagenome and metatranscriptome databases, which we show have far less of the culture bias present in primer-amplified 16S rRNA gene surveys, to those of their nearest cultured relatives. Whether normalized to scaffold read depths or not, the highest abundances of metagenomic 16S rRNA gene sequences belong to phylogenetically novel uncultured groups in seawater, freshwater, terrestrial subsurface, soil, hypersaline environments, marine sediment, hot springs, hydrothermal vents, nonhuman hosts, snow, and bioreactors (22% to 87% uncultured genera to classes and 0% to 64% uncultured phyla). The exceptions were human and human-associated environments, which were dominated by cultured genera (45% to 97%). We estimate that uncultured genera and phyla could comprise 7.3 × 10²⁹ (81%) and 2.2 × 10²⁹(25%) of microbial cells, respectively. Uncultured phyla were overrepresented in metatranscriptomes relative to metagenomes (46% to 84% of sequences in a given environment), suggesting that they are viable. Therefore, uncultured microbes, often from deeply phylogenetically divergent groups, dominate nonhuman environments on Earth, and their undiscovered physiologies may matter for Earth systems.

Abstract

My research focused on developing quantitative and theoretical frameworks to better understand microbial diversity. I explored topics which include:

1. How microbial community diversity influences genome (metagenome-assembled genome) discovery in short read sequencing studies. I proposed using a coupon collector, a general probability sampling model, to predict the sequencing effort needed to sequence rare genomes.
2. Evaluating the relationship between microbial lineage and genomic trait composition. I evaluated ~120,000 publicly available genomes for patterns in cluster of orthologous groups with respect to taxonomy. Taxonomic ranks spanning domain through genus had significant explanatory power on how traits are distributed across the tree of life. More so, this indicates taxonomy, even at higher taxonomic resolutions, can act as a proxy for certain genomic features.
3. Quantitatively measuring how disperse microbial traits are across microbial communities. Traits are said to be more functionally redundant when possessed by more community members. I applied concepts from traditional diversity theory to measure how evenly microbes in communities contribute to an aggregated ecosystem function.

Abstract

Aquatic sediments harbor diverse microbial communities that mediate organic matter degradation and influence biogeochemical cycles. The pool of bioavailable carbon continuously changes as a result of abiotic processes and microbial activity. It remains unclear how microbial communities respond to heterogeneous organic matrices and how this ultimately affects heterotrophic respiration. To explore the relationships between the degradation of mixed carbon substrates and microbial activity, we incubated batches of organic-rich sediments in a novel bioreactor (IsoCaRB) that permitted continuous observations of CO₂ production rates, as well as sequential sampling of isotopic signatures (δ¹³C, Δ¹⁴C), microbial community structure and diversity, and extracellular enzyme activity. Our results indicated that lower molecular weight (MW), labile, phytoplankton-derived compounds were degraded first, followed by petroleum-derived exogenous pollutants, and finally by higher MW polymeric plant material. This shift in utilization coincided with a community succession and increased extracellular enzyme activities. Thus, sequential utilization of different carbon pools induced changes at both the community and cellular level, shifting community composition, enzyme activity, respiration rates, and residual organic matter reactivity. Our results provide novel insight into the accessibility of sedimentary organic matter and demonstrate how bioavailability of natural organic substrates may affect the function and composition of heterotrophic bacterial populations. This article is protected by copyright. All rights reserved.

Acquisition Description

Processing Description

Instruments

Parameters

Dataset Maintainers

BCO-DMO Project Info

Project Description

Data Project Maintainers

Acquisition Description

Primer name     Sequence (5' - 3')           Target          Reference
Bac340f         TCCTACGGGAGGCAGCAGT          Bacteria        Nadkarni et al., 2002
Bac 515r        CGTATTACCGCGGCTGCTGGCAC      Bacteria        Nadkarni et al., 2002
Arch915f        GTGCTCCCCCGCCAATTCCT         Archaea         Kubo et al., 2012
Arch1059r       GCCATGCACCWCCTCT             Archaea         Kubo et al., 2012
ANME1-628f      GCT TTC AGG GAA TAC TGC      ANME-1          Lloyd et al., 2011
ANME1-830r      TCG CAG TAA TGC CAA CAC      ANME-1          Lloyd et al., 2011
MCG528f         CGGTAATACCAGCTCTCCGAG                        Kubo et al., 2012
MCG732r         CGCGTTCTAGCCGACAGC                           Kubo et al., 2012

Processing Description

Instruments

Parameters

Dataset Maintainers

BCO-DMO Project Info

Project Description

Data Project Maintainers

Acquisition Description

Processing Description

Instruments

Parameters

Dataset Maintainers

BCO-DMO Project Info

Project Description

Data Project Maintainers

Acquisition Description

Processing Description

Instruments

Parameters

Dataset Maintainers

BCO-DMO Project Info

Project Description

Data Project Maintainers

Acquisition Description

Processing Description

Instruments

Parameters

Dataset Maintainers

BCO-DMO Project Info

Project Description

Data Project Maintainers

Project Description

Data Project Maintainers

Project Description

Data Project Maintainers

Project Description

Data Project Maintainers

Abstract

This proposal was based on the hypothesis that hydroxyl radical may be produced via radiolysis reactions in deep marine sediments, and that these reactive oxygen species may then proceed to liberate bioavailable organic matter by reacting with recalcitrant sedimentary organic matter. During the period of this grant, we worked on improved techniques to quantify hydroxyl radicals in anoxic water, to quantify hydroxyl radicals in estuarine sediments, to determine the effect of hydroxyl on DOM composition, and to determine the effect of hydroxyl radicals on DOM bioavailability. These experiments generated data that were inconclusive and/or difficult to interpret. While this grant supported two undergraduate students and a lab technician in her first job after graduation and generated five presentations at meetings, it requires more analytical work before the results can be published.

Abstract

Marine sediments host a large population of diverse, heterotrophic, uncultured microorganisms with unknown physiologies that control carbon flow through organic matter decomposition. Recently, single-cell genomics uncovered new key players in these processes, such as the miscellaneous crenarchaeotal group. These widespread archaea encode putative intra- and extracellular proteases for the degradation of detrital proteins present in sediments. Here, we show that one of these enzymes is a self-compartmentalizing tetrameric aminopeptidase with a preference for cysteine and hydrophobic residues at the N terminus of the hydrolyzed peptide. The ability to perform detailed characterizations of enzymes from native subsurface microorganisms, without requiring that those organisms first be grown in pure culture, holds great promise for understanding key carbon transformations in the environment as well as identifying new enzymes for biomedical and biotechnological applications.

Abstract

The identities and biochemical properties of extracellular enzymes present in natural environments are poorly constrained. We used a series of competitive inhibition experiments with samples from a freshwater environment (the Tennessee River at Knoxville, TN, USA) and a marine environment (Bogue Sound, NC, USA) to characterize the range of substrate specificities of naturally occurring enzymes that hydrolyze L-leucine 7-amido-4-methylcoumarin (Leu-AMC), L‑proline-AMC (Pro-AMC), and L-arginine-AMC (Arg-AMC)—putative substrates for leucyl-aminopeptidase, prolyl-aminopeptidase, and arginyl-aminopeptidase, respectively. Extracellular peptidases which hydrolyzed Arg-AMC and Leu-AMC demonstrated affinity for up to 8 other amino acids, whereas those hydrolyzing Pro-AMC in the Tennessee River, and Arg-AMC at Bogue Sound, were more specific to proline and arginine, respectively. Patterns of substrate affinity showed that Leu-AMC (at both sampling sites) and Arg-AMC (at Bogue Sound) were primarily hydrolyzed by enzymes other than leucyl-aminopeptidase and arginyl-aminopeptidase, respectively. The set of naturally occurring peptidases in both environments showed greater affinity towards a subset of amino acids. These amino acids were on average larger, yielded more free energy from oxidation to CO₂, and tended to be depleted in aged organic matter. These relationships indicate that pathways of amino acid diagenesis are at least partially controlled by the substrate specificities of the peptidases involved in protein degradation.

Abstract

Half of the microbial cells in the Earth’s oceans are found in sediments. Many of these cells are members of the Archaea, single-celled prokaryotes in a domain of life separate from Bacteria and Eukaryota. However, most of these archaea lack cultured representatives, leaving their physiologies and placement on the tree of life uncertain. Here we show that the uncultured miscellaneous crenarchaeotal group (MCG) and marine benthic group-D (MBG-D) are among the most numerous archaea in the marine sub-sea floor. Single-cell genomic sequencing of one cell of MCG and three cells of MBG-D indicated that they form new branches basal to the archaeal phyla Thaumarchaeota and Aigarchaeota, for MCG, and the order Thermoplasmatales, for MBG-D. All four cells encoded extracellular protein-degrading enzymes such as gingipain and clostripain that are known to be effective in environments chemically similar to marine sediments. Furthermore, we found these two types of peptidase to be abundant and active in marine sediments, indicating that uncultured archaea may have a previously undiscovered role in protein remineralization in anoxic marine sediments.

Abstract

There is no universally accepted method to quantify bacteria and archaea in seawater and marine sediments, and different methods have produced conflicting results with the same samples. To identify best practices, we compiled data from 65 studies, plus our own measurements, in which bacteria and archaea were quantified with fluorescent in situ hybridization (FISH), catalyzed reporter deposition FISH (CARD-FISH), polyribonucleotide FISH, or quantitative PCR (qPCR). To estimate efficiency, we defined “yield” to be the sum of bacteria and archaea counted by these techniques divided by the total number of cells. In seawater, the yield was high (median, 71%) and was similar for FISH, CARD-FISH, and polyribonucleotide FISH. In sediments, only measurements by CARD-FISH in which archaeal cells were permeabilized with proteinase K showed high yields (median, 84%). Therefore, the majority of cells in both environments appear to be alive, since they contain intact ribosomes. In sediments, the sum of bacterial and archaeal 16S rRNA gene qPCR counts was not closely related to cell counts, even after accounting for variations in copy numbers per genome. However, qPCR measurements were precise relative to other qPCR measurements made on the same samples. qPCR is therefore a reliable relative quantification method. Inconsistent results for the relative abundance of bacteria versus archaea in deep subsurface sediments were resolved by the removal of CARD-FISH measurements in which lysozyme was used to permeabilize archaeal cells and qPCR measurements which used ARCH516 as an archaeal primer or TaqMan probe. Data from best-practice methods showed that archaea and bacteria decreased as the depth in seawater and marine sediments increased, although archaea decreased more slowly.

Abstract

Extracellular enzymes produced by heterotrophic microbial communities are major drivers of carbon and nutrient cycling in terrestrial, freshwater, and marine environments. Although carbon and nutrient cycles are coupled on global scales, studies of extracellular enzymes associated with terrestrial, freshwater, and marine microbial communities are not often compared across ecosystems. In part, this disconnect arises because the environmental parameters that control enzyme activities in terrestrial and freshwater systems, such as temperature, pH, and moisture content, have little explanatory power for patterns of enzyme activities in marine systems. Instead, factors such as the functional diversity of microbial communities may explain varying patterns of enzyme activities observed in the ocean to date. In any case, many studies across systems focus on similar issues that highlight the commonalities of microbial community organization. Examples include the effective lifetime of enzymes released into the environment; the extent to which microbial communities coordinate enzyme expression to decompose complex organic substrates; and the influence of microbial community composition on enzyme activities and kinetics. Here we review the often-disparate research foci in terrestrial, freshwater, and marine environments. We consider the extent to which environmental factors may regulate extracellular enzyme activities within each ecosystem, and highlight commonalities and current methodological challenges to identify research questions that may aid in integrating cross-system perspectives in the future.

Abstract

The goal of this project was to explore the mechanisms of subsurface organoheterotrophy by identifying the range of extracellular peptidases present in sediments of the White Oak River, NC, consistent with C-DEBI Research Theme 1, Activity in the Deep Subseafloor Biosphere: function & rates of global biogeochemical processes. This grant funded two sampling expeditions to the White Oak River as well as extensive laboratory work with a purified peptidase that was supplied by collaborators Andrzej Joachimiak and Karolina Michalska of Argonne National Laboratory and preparatory work on peptidases of the Tennessee River. So far this dataset has led to the submission of two manuscripts, with one more manuscript in preparation. The White Oak River work showed that a wide range of peptidases are present in depths up to 80cm in the White Oak River, which is deeper than the zone of methanogenesis. Although absolute peptidase activities declined with depth, activities normalized to cell abundance were roughly constant, and activities normalized to organic carbon oxidation rates increased nearly two orders of magnitude relative to the surface, indicating that extracellular peptidases were important to the subsurface ecosystem. Biochemical analysis of a purified peptidase that was expressed by the Argonne group showed it to be a novel aminopeptidase with specificity for N-terminal cysteine, a function not previously observed in peptidses. In summary, in situ and in vitro studies of subsurface peptidases revealed that they are ecologically important and may contain novel properties.

Abstract

Heterotrophy supports much of the energy-starved life in the deep biosphere, yet we know almost nothing about the pathways by which organic matter (OM) is remineralized in the deep subseafloor. The microbes responsible for OM breakdown in the subsurface are taxonomically diverse, but their lack of resemblance to well-characterized lab cultures makes it impossible to use taxonomy alone to predict the nature of their interactions with OM. Even when metagenomes or metatranscriptomes are available to provide functional information, common analysis tools only categorize annotated genes into general classes that do not distinguish between degradative, synthetic, or housekeeping processes. We approached this problem by expressing, purifying, characterizing, and analyzing proteins from the uncultured phylum, Bathyarchaeota. We explored the possibilities for long term starvation in marine organisms in a review paper, and developed software for data processing of OM degradation. We monitored marine sediments in lab to look for growth dynamics in natural populations of microbes, and quantified the abundance and evolutionary distance of uncultured microbes in the public database. In total, we were able to identify new potential roles for uncultured archaea in OM degradation.